ACGTACGTACGTACGTACGTAC

Design your own mRNAcancer vaccine.

An open studio for personalized mRNA cancer vaccines. Sequence the tumor, run the studio on your machine, hand the design to a manufacturer — for dogs, cats, and humans.

Get started on GitHub→
The app

The studio runs on your machine.

Eight stages, twelve hours, one vaccine. No cloud, no data leaves your lab — step through every stage below, or let it play.

●localhost:3000 — mutavax / Intake
v0.6
Biscuit — GSD mast cell tumor / 01 Ingestion

The tumor sample and the healthy sample.

Drop in two sets of DNA files: one from the tumor, one from healthy tissue. We check them, show a quick preview, and get everything ready for the next step. No renaming or reformatting on your end.

Stage 01 · Live
CanFam4
Both samples look good. You're ready for the next step.

Click Align reads to match the DNA to the reference genome.

Align reads →
Sample · healthy

Matched normal

Healthy reference — what to compare against.

Ready
No files yet. Pick your healthy sample files.
Sample · tumor

Tumor

Biopsy — the cancer.

Ready
No files yet. Pick your tumor sample files.
Demo fixture · stage 01 · Ingest
Click a stage in the sidebar to jump ↗
  1. 01
    Sample.

    Sequence the tumor.

    A biopsy plus a matched healthy sample. Two sequencing files from any veterinary lab.

    A
  2. 02
    Compute.

    Find the mutations.

    Eight pipeline stages compare tumor against healthy and design the vaccine. ~12 hours on your workstation.

    C
  3. 03
    Design.

    Make the vaccine.

    One finished design, sent to a GMP partner. A personalized mRNA vial arrives within ten days.

    G